|
|
Marker Overview
| Name | Bf0116 |
|---|
| dbSNP ID | N/A |
|---|
| Type | SNP |
|---|
| SNP Alleles | N/A |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Bf0116.Forward Primer: CGTTGACGGGGTTTCCTC |
|---|
| Primer 2 | Bf0116.Reverse Primer: ACCTGAAGCGCGTGAATAGAA |
|---|
| Product Length | 1400 |
|---|
| Restriction Enzyme | SI260 |
|---|
| Publication | [view all] |
|---|
| Contact | S. Ohta
Mitsuo Omura
|
|---|
Publications
| Year | Publication |
|---|
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
| 2016 | Peng H, Wei Z, Luo H, Yang Y, Wu Z, Gan L, Yang X. Inhibition of Fat Accumulation by Hesperidin in Caenorhabditis elegans. Journal of agricultural and food chemistry. 2016 Jun 7. |
|
