|
Marker Overview
Name | Ov0117 |
dbSNP ID | N/A |
Type | SNP |
SNP Alleles | N/A |
Species | Citrus spp. |
Primer 1 | Ov0117.Taqman F Primer: GGCTCAAAATCCGGATAAGGGAATA |
Primer 2 | Ov0117.Taqman R primer: AATTTGCACATTCTGGCTATGAAGTG |
Primer 3 | Ov0117.Taqman probe FAM: TCAACATCAAAGCATCTT |
Primer 4 | Ov0117.Taqman probe VIC: CAACATCAAGGCATCTT |
Publication | [view all] |
Contact | Mitsuo Omura S. Ohta
|
Publications
Year | Publication |
2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Huang R, O'Donnell AJ, Barboline JJ, Barkman TJ. Convergent evolution of caffeine in plants by co-option of exapted ancestral enzymes. Proceedings of the National Academy of Sciences of the United States of America. 2016 Sep 20; 113(38):10613-8. |
|