TAA1, TAA1 (genetic_marker) Citrus spp. | Citrus Genome Database

Marker Overview

Marker Overview


Name	TAA1
Genbank ID	N/A
Type	SSR
Species	Citrus spp.
Repeat Motif	TAA
Primer 1	TAA1.Forward Primer: GACAACATCAACAACAGCAAGAGC
Primer 2	TAA1.Reverse Primer: AAGAAGAAGAGCCCCCATTAGC
Publication	[view all]
Contact	Wen-Wu Guo A. Nematollahi Behrouz Golein X.X. Deng MJ Asins M Thomas Qi-bin Hong

Contact

Name

Details

Wen-Wu Guo

First name:	Wen-Wu
Last name:	Guo
Title:	Researcher
Institution:	Huazhong Agricultural University
Address:	Key Laboratory of Horticultural Plant Biology (Ministry of Education), Huazhong Agricultural University, Wuhan 430070, China
Country:	China
Email:	guoww@mail.hzau.edu.cn
Phone:	+86 27 8728 1543
Fax:	+86 27 8728 0016

A. Nematollahi

First name:	A.
Last name:	Nematollahi
Title:	Researcher
Institution:	College of Abouraihan
Address:	Department of Horticulture, College of Abouraihan, University of Tehran, Tehran, Iran
Country:	Iran

Behrouz Golein

First name:	Behrouz
Last name:	Golein
Title:	Researcher
Institution:	Iran Citrus Research Institute
Address:	Department of Plant Breeding and Improvement, Iran Citrus Research Institute, Ramsar, Islamic Republic of Iran
Country:	Iran
Email:	bgoleincitrus@yahhoo.com
Phone:	+98 9113945261
Fax:	+98 1925223282

X.X. Deng

First name:	X.X.
Last name:	Deng
Title:	Researcher
Institution:	Huazhong Agricultural University
Address:	National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, P.R. China
Country:	China
Email:	dxxwwlj@public.wh.hb.cn

MJ Asins

First name:	MJ
Last name:	Asins
Title:	Researcher
Institution:	IVIA
Address:	Instituto Valenciano de Investigaciones Agrarias (IVIA), Apartado Oficial, 46113 Moncada (Valencia), Spain
Country:	Spain
Email:	mjasins@ivia.es
Fax:	+34-961390240

M Thomas

First name:	M
Last name:	Thomas
Institution:	CSIRO
Address:	CSIRO, Division of Horticulture, GPO Box 350, Adelaide, S.A 5001, Australia

Qi-bin Hong

First name:	Qi-Bin
Last name:	Hong
Title:	Researcher
Institution:	Chinese Academy of Agricultural Sciences/Southwest University
Address:	Citrus Research Institute, Chinese Academy of Agricultural Sciences/Southwest University, National Citrus Engineering Research Center, Chongqing, P.R. China
Country:	China
Email:	hongqb@sina.com

Publications


Year	Publication
2009	Khadem Nematollahi A, Vahdati K, Nabipour A, Golein B, Danesh M. Assessment of genetic variation in citrus germplasm of South of Iran using SSR markers. Acta horticulturae. 2009; (839)549-554.
2007	Cai X, Fu J, Deng X, Guo W. Production and molecular characterization of potential seedless cybrid plants between pollen sterile Satsuma mandarin and two seedy Citrus cultivars. Plant cell, tissue, and organ culture. 2007; 90(3):275-283.
2012	Golein B, Bigonah M, Azadvar M, Golmohammadi M. Analysis of genetic relationship between 'Bakraee' (Citrus sp.) and some known Citrus genotypes through SSR and PCR-RFLP markers. Scientia horticulturae. 2012; 147-153.
2002	Liu J, Pang X, Cheng Y, Meng H, Deng X. Molecular characterization of the nuclear and cytoplasmic genomes of intergeneric diploid plants from cell fusion between Microcitrus papuana and Rough lemon. Plant cell reports. 2002 Nov; 21(4):327-332.
2012	Raga V, Bernet GP, Carbonell EA, Asíns MJ. Segregation and linkage analyses in two complex populations derived from the citrus rootstock Cleopatra mandarin. Inheritance of seed reproductive traits. Tree Genetics and Genomes. 2012; 8(5):1061-1071.
1997	Kijas J, Thomas M, Fowler J, Roose M. Integration of trinucleotide microsatellites into a linkage map of Citrus. Theoretical and applied genetics. 1997 Apr; 94(5):701-706.
2015	Hong Q, Ma X, Gong G, Peng Z, He Y. QTL mapping of citrus freeze tolerance. Acta horticulturae. 2015; (1065)467-474.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Poncirus-FlyingDragon/FlyingDragon-RIL-2003	Pp2	N/A	8.7	TAA1	View
2	Citrus-AfinVerna/FlyingDragon-AfinVerna-F1-2002	Pa2	N/A	22.4	TAA1	View
3	Citrus-Volkamer/Rubidoux-Volkamer-F1-2003	V3	N/A	25.4	TAA1	View
4	Citrus-Sacaton/Troyer-RIL-1997	K	N/A	32	TAA1	View
5	Citrus-Li2/Wan2-F1-2015	LG8	N/A	-10.8	TAA1	View
6	Citrus-Cleopatra/Trifoliatesp-F2-2012	RPr2	N/A	0	TAA1, 175	View