TAA15, TAA15 (genetic_marker) Citrus spp. | Citrus Genome Database

Marker Overview

Marker Overview


Name	TAA15
Genbank ID	N/A
Type	SSR
Species	Citrus spp.
Repeat Motif	TAA
Primer 1	TAA15.Forward Primer: GAAAGGGTTACTTGACCAGGC
Primer 2	TAA15.Reverse Primer: CTTCCCAGCTGCACAAGC
Publication	[view all]
Contact	Wen-Wu Guo A. Nematollahi Behrouz Golein X.X. Deng Osman Gulsen MJ Asins M Thomas Qi-bin Hong

Contact

Name

Details

Wen-Wu Guo

First name:	Wen-Wu
Last name:	Guo
Title:	Researcher
Institution:	Huazhong Agricultural University
Address:	Key Laboratory of Horticultural Plant Biology (Ministry of Education), Huazhong Agricultural University, Wuhan 430070, China
Country:	China
Email:	guoww@mail.hzau.edu.cn
Phone:	+86 27 8728 1543
Fax:	+86 27 8728 0016

A. Nematollahi

First name:	A.
Last name:	Nematollahi
Title:	Researcher
Institution:	College of Abouraihan
Address:	Department of Horticulture, College of Abouraihan, University of Tehran, Tehran, Iran
Country:	Iran

Behrouz Golein

First name:	Behrouz
Last name:	Golein
Title:	Researcher
Institution:	Iran Citrus Research Institute
Address:	Department of Plant Breeding and Improvement, Iran Citrus Research Institute, Ramsar, Islamic Republic of Iran
Country:	Iran
Email:	bgoleincitrus@yahhoo.com
Phone:	+98 9113945261
Fax:	+98 1925223282

X.X. Deng

First name:	X.X.
Last name:	Deng
Title:	Researcher
Institution:	Huazhong Agricultural University
Address:	National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, P.R. China
Country:	China
Email:	dxxwwlj@public.wh.hb.cn

Osman Gulsen

First name:	Osman
Last name:	Gulsen
Title:	Researcher
Institution:	Erciyes University, Turkey
Address:	Erciyes University, Faculty of Agriculture, Department of Horticulture, 38039 Melikgazi, Kayseri, Turkey
Country:	Turkey
Email:	o_gulsen@yahoo.com
Phone:	+90 352 4374901
Fax:	+90 352 4376902

MJ Asins

First name:	MJ
Last name:	Asins
Title:	Researcher
Institution:	IVIA
Address:	Instituto Valenciano de Investigaciones Agrarias (IVIA), Apartado Oficial, 46113 Moncada (Valencia), Spain
Country:	Spain
Email:	mjasins@ivia.es
Fax:	+34-961390240

M Thomas

First name:	M
Last name:	Thomas
Institution:	CSIRO
Address:	CSIRO, Division of Horticulture, GPO Box 350, Adelaide, S.A 5001, Australia

Qi-bin Hong

First name:	Qi-Bin
Last name:	Hong
Title:	Researcher
Institution:	Chinese Academy of Agricultural Sciences/Southwest University
Address:	Citrus Research Institute, Chinese Academy of Agricultural Sciences/Southwest University, National Citrus Engineering Research Center, Chongqing, P.R. China
Country:	China
Email:	hongqb@sina.com

Publications


Year	Publication
2009	Khadem Nematollahi A, Vahdati K, Nabipour A, Golein B, Danesh M. Assessment of genetic variation in citrus germplasm of South of Iran using SSR markers. Acta horticulturae. 2009; (839)549-554.
2006	Guo W, Cheng Y, Chen C, Deng X. Molecular analysis revealed autotetraploid, diploid and tetraploid cybrid plants regenerated from an interspecific somatic fusion in Citrus. Scientia horticulturae. 2006; 108:162-166.
2012	Golein B, Bigonah M, Azadvar M, Golmohammadi M. Analysis of genetic relationship between 'Bakraee' (Citrus sp.) and some known Citrus genotypes through SSR and PCR-RFLP markers. Scientia horticulturae. 2012; 147-153.
2002	Liu J, Pang X, Cheng Y, Meng H, Deng X. Molecular characterization of the nuclear and cytoplasmic genomes of intergeneric diploid plants from cell fusion between Microcitrus papuana and Rough lemon. Plant cell reports. 2002 Nov; 21(4):327-332.
2010	Gulsen O, Uzun A, Canan I, Seday U, Canihos E. A new citrus linkage map based on SRAP, SSR, ISSR, POGP, RGA and RAPD markers. Euphytica. 2010; 173(2):265-277.
2012	Raga V, Bernet GP, Carbonell EA, Asíns MJ. Segregation and linkage analyses in two complex populations derived from the citrus rootstock Cleopatra mandarin. Inheritance of seed reproductive traits. Tree Genetics and Genomes. 2012; 8(5):1061-1071.
1997	Kijas J, Thomas M, Fowler J, Roose M. Integration of trinucleotide microsatellites into a linkage map of Citrus. Theoretical and applied genetics. 1997 Apr; 94(5):701-706.
2015	Hong Q, Ma X, Gong G, Peng Z, He Y. QTL mapping of citrus freeze tolerance. Acta horticulturae. 2015; (1065)467-474.
2016	Raga V, Intrigliolo DS, Bernet GP, Carbonell EA, Asins MJ. Genetic analysis of salt tolerance in a progeny derived from the citrus rootstocks Cleopatra mandarin and trifoliate orange. Tree Genetics & Genomes. 2016; 12:34.
2003	Ruiz C, Asins M. Comparison between Poncirus and Citrus genetic linkage maps. Theoretical and applied genetics. 2003 Mar; 106(5):826-836.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Poncirus-FlyingDragon/FlyingDragon-RIL-2003	Pp II	N/A	0	TAA15	View
2	Citrus-AfinVerna/FlyingDragon-AfinVerna-F1-2002	A6	N/A	0	TAA15	View
3	Citrus-Volkamer/Rubidoux-Volkamer-F1-2003	V 6	N/A	0	TAA15	View
4	Citrus-AfinVerna/FlyingDragon-AfinVerna-F1-2003	A 6	N/A	0	TAA15	View
5	Citrus-Sacaton/Troyer-RIL-1997	I	N/A	10	TAA15	View
6	Citrus-Li2/Wan2-F1-2015	LG9	N/A	53.1	TAA15	View
7	Citrus-Orlando/Clementine-F1-Clementine-2010	Clem-4	N/A	38	SSRTAA15.500	View
8	Citrus-Orlando/Clementine-F1-Orlando-2010	Orl-5	N/A	34	SSRTAA15.600	View
9	Poncirus-Rich/FlyingDragon-F1-2012	Pr8+6b	N/A	2	TAA15, 170	View
10	Citrus-Cleopatra/Trifoliatesp-F2-2012	RPr8+6	N/A	32	TAA15, 170	View
11	Citrus-Cleopatra/P.trifoliata-P.trifoliata-F1-2016	p6	N/A	15.37	TAA15,170	View