TAA41, TAA41 (genetic_marker) Citrus spp. | Citrus Genome Database

Marker Overview

Marker Overview


Name	TAA41
Genbank ID	N/A
Type	SSR
Species	Citrus spp.
Repeat Motif	TAA
Primer 1	TAA41.Forward Primer: AGGTCTACATTGGCATTGTC
Primer 2	TAA41.Reverse Primer: ACATGCAGTGCTATAATGAATG
Publication	[view all]
Contact	Sergio Ferrante Behrouz Golein X.X. Deng MJ Asins M Thomas Qi-bin Hong

Contact

Name

Details

Sergio Ferrante

First name:	Sergio
Last name:	Ferrante
Title:	Researcher
Institution:	Institute of Plant Genetics (Research Division of Palermo)
Address:	CNR—Institute of Plant Genetics (Research Division of Palermo), Corso Calatafimi 414, 90129 Palermo, Italy
Country:	Italy
Email:	sergiopietro.ferrante@igv.cnr.it

Behrouz Golein

First name:	Behrouz
Last name:	Golein
Title:	Researcher
Institution:	Iran Citrus Research Institute
Address:	Department of Plant Breeding and Improvement, Iran Citrus Research Institute, Ramsar, Islamic Republic of Iran
Country:	Iran
Email:	bgoleincitrus@yahhoo.com
Phone:	+98 9113945261
Fax:	+98 1925223282

X.X. Deng

First name:	X.X.
Last name:	Deng
Title:	Researcher
Institution:	Huazhong Agricultural University
Address:	National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, P.R. China
Country:	China
Email:	dxxwwlj@public.wh.hb.cn

MJ Asins

First name:	MJ
Last name:	Asins
Title:	Researcher
Institution:	IVIA
Address:	Instituto Valenciano de Investigaciones Agrarias (IVIA), Apartado Oficial, 46113 Moncada (Valencia), Spain
Country:	Spain
Email:	mjasins@ivia.es
Fax:	+34-961390240

M Thomas

First name:	M
Last name:	Thomas
Institution:	CSIRO
Address:	CSIRO, Division of Horticulture, GPO Box 350, Adelaide, S.A 5001, Australia

Qi-bin Hong

First name:	Qi-Bin
Last name:	Hong
Title:	Researcher
Institution:	Chinese Academy of Agricultural Sciences/Southwest University
Address:	Citrus Research Institute, Chinese Academy of Agricultural Sciences/Southwest University, National Citrus Engineering Research Center, Chongqing, P.R. China
Country:	China
Email:	hongqb@sina.com

Publications


Year	Publication
2010	Ferrante SP, Lucretti S, Reale S, De Patrizio A, Abbate L, Tusa N, Scarano M. Assessment of the origin of new citrus tetraploid hybrids (2n = 4x) by means of SSR markers and PCR based dosage effects. Euphytica. 2010; 173(2):223-233.
2012	Golein B, Bigonah M, Azadvar M, Golmohammadi M. Analysis of genetic relationship between 'Bakraee' (Citrus sp.) and some known Citrus genotypes through SSR and PCR-RFLP markers. Scientia horticulturae. 2012; 147-153.
2002	Liu J, Pang X, Cheng Y, Meng H, Deng X. Molecular characterization of the nuclear and cytoplasmic genomes of intergeneric diploid plants from cell fusion between Microcitrus papuana and Rough lemon. Plant cell reports. 2002 Nov; 21(4):327-332.
2012	Raga V, Bernet GP, Carbonell EA, Asíns MJ. Segregation and linkage analyses in two complex populations derived from the citrus rootstock Cleopatra mandarin. Inheritance of seed reproductive traits. Tree Genetics and Genomes. 2012; 8(5):1061-1071.
1997	Kijas J, Thomas M, Fowler J, Roose M. Integration of trinucleotide microsatellites into a linkage map of Citrus. Theoretical and applied genetics. 1997 Apr; 94(5):701-706.
2015	Hong Q, Ma X, Gong G, Peng Z, He Y. QTL mapping of citrus freeze tolerance. Acta horticulturae. 2015; (1065)467-474.
2016	Raga V, Intrigliolo DS, Bernet GP, Carbonell EA, Asins MJ. Genetic analysis of salt tolerance in a progeny derived from the citrus rootstocks Cleopatra mandarin and trifoliate orange. Tree Genetics & Genomes. 2016; 12:34.
2003	Ruiz C, Asins M. Comparison between Poncirus and Citrus genetic linkage maps. Theoretical and applied genetics. 2003 Mar; 106(5):826-836.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Poncirus-FlyingDragon/FlyingDragon-RIL-2003	Pp5b	N/A	5.9	TAA41	View
2	Citrus-AfinVerna/FlyingDragon-AfinVerna-F1-2002	Pa5ab	N/A	78.4	TAA41	View
3	Citrus-AfinVerna/FlyingDragon-AfinVerna-F1-2002	A5b	N/A	0.6	TAA41	View
4	Citrus-Volkamer/Rubidoux-Volkamer-F1-2003	Pv5b	N/A	58.1	TAA41	View
5	Citrus-Volkamer/Rubidoux-Volkamer-F1-2003	V5b	N/A	17.8	TAA41	View
6	Citrus-Volkamer/Rubidoux-Volkamer-F1-1996	V6	N/A	0	TAA41	View
7	Citrus-Li2/Wan2-F1-2015	LG2	N/A	26.7	TAA41	View
8	Citrus-Orlando/Clementine-F1-Orlando-2010	Orl-1	N/A	153	SSRTAA41.145	View
9	Poncirus-Rich/FlyingDragon-F1-2012	Pr10+5b	N/A	11	TAA41, 16	View
10	Citrus-Cleopatra/FlyingDragon-Cleopatra-F1-2012	R10+5b	N/A	0	TAA41, 160	View
11	Poncirus-Rich/FlyingDragon-F1-2012	Pr10+5b	N/A	11	TAA41, 160	View
12	Citrus-Cleopatra/FlyingDragon-FlyingDragon-F1-2012	Rf10+5b	N/A	4	TAA41, 160	View
13	Citrus-Cleopatra/Rich-Rich-F1-2012	Rr10+5b	N/A	27	TAA41, 160	View
14	Poncirus-FlyingDragon/FlyingDragon-F2-2000	Prf10+5a	N/A	0	TAA41, 160	View
15	Poncirus-Rich/Rich-F2-2000	Prr10+5b(a)	N/A	26	TAA41, 160	View
16	Citrus-Cleopatra/P.trifoliata-Cleopatra-F1-2016	r10+5b	N/A	33.32	TAA41,160	View
17	Citrus-Cleopatra/P.trifoliata-P.trifoliata-F1-2016	p10+5b	N/A	19.1	TAA41,160	View
18	Citrus-R/Pr-2023	R10+5b	N/A	35.81	TAA41,160	View